V. a role of the ribbon in active zone stabilization and suggest a homeostatic function of the ribbon in illumination-dependent active zone remodeling. the relevant guidelines and regulations and have been reviewed and approved by the responsible authority (Landesamt fr Verbraucherschutz, Gesch?ftsbereich 3: Amtstier?rztlicher Dienst, 66115 Saarbrcken, Germany). RIBEYE knockout mice used in respective experiments were previously described15. Cav1.4 knockout retinal tissue35 was kindly provided by Prof. Dr. M. Biel (Munich, Germany) and Prof. Dr. V. Flockerzi (Homburg, Germany). Unless denoted otherwise, mice were picked up from the animal house between 3pm-4pm and sacrificed in the laboratory between 4:30pm and 7pm. Mice were dissected within 5 min post mortem at 30 cd/m2. Light and dark adaptation of mice For light and dark adaptation experiments, 10C12 weeks old mice were used. To exclude circadian Rosuvastatin influences, mice were uncovered always at the same time (12 am, noon), in parallel, for 4.5 hr either to light (30 cd/m2) or to a completely dark environment ( 0.008 cd/m2). The light adaptation experiments thus always started at 12 am (noon) and eyes were removed and processed 4.5 hr later, at 4:30 pm. Mice were anaesthetized with isoflurane and euthanized by cervical dislocation. Isolation of eyes from dark-adapted mice was done in complete darkness under infrared light provided by two infrared illuminators (Conrad Electronics, Model no. CCD-328H; 750965). The standard binocular system used for detection of visible light was replaced by two FJW optical system infrared viewers (Cat. No. 84499A). Two infrared illuminators (Conrad Electronics, Model no. CCD-328H; 750965) were placed close to the dissecting stage from lateral sides together with an additional infrared light (NITECORE, Chameleon series CI6, 850 nm infrared light, 1500 mW). Rosuvastatin Around the microscope stage, the posterior eyecup with the light-sensitive retina was isolated and flash-frozen in liquid nitrogen-cooled isopentane as described36,37. For the dark-adapted retinas, also the freezing of the posterior eyecup was performed in complete darkness with the help of infrared light illumination. Further processing of the samples was done as previously described36,37. For indicated experiments (analysis of the illumination-dependent kinetics of ribbon- and active zone dynamics), dark-adapted animals were Rosuvastatin re-exposed to light (30 cd/m2) for defined periods of time, (i.e. for 20 min, 40 min and 60 min, respectively) before eyes were dissected as described above. Generation of photoreceptor-specific RIM1 and RIM2 single knock-out mice from photoreceptor-specific RIM1/2 double knockout mice for the characterization of RIM antibodies For validation of a RIM2 rabbit polyclonal antibody (RIM2poly) and of a newly generated RIM2-specific mouse monoclonal antibody (4F7), photoreceptor-specific RIM1 or RIM2 single knockout (SKO) mice were generated by breeding floxed RIM1,2 cDKO [RIM1:fl/fl; RIM2:fl/fl3,27] carrying the LMOP-Cre transgene27 with wildtype C57BL/6J mice to obtain a Rosuvastatin first generation of heterozygous mice (each with one wild-type and knockout allele for the RIM1 and RIM2 locus, respectively). These heterozygous mice, containing also LMOP-Cre, were back-crossed with floxed RIM1,2 (RIM1:fl/fl; RIM2:fl/fl) mice to generate homozygous conditional knockout alleles for either RIM1 or RIM2 with a heterozygous allele for the respective other RIM gene. The following primers were used for genotyping: RIM1forward: ACGTTTGCAGCAGAGATGC, RIM1reverse: CCTTCCACAGTCTGCATTCC; RIM2forward: GCCAAAGAGTAGAGTGTTGG TGG, RIM2reverse: GGTGTCTGCATCCAGTGGAGC. The presence of the Cre transgene was confirmed with forward primer: GGTTTCCCGCAGAACCTGAA and reverse primer: AGCCTGTTTTGCACGTTCACC. Antibodies Cav1.4 antibodies Cav1.4-16D9 Mouse monoclonal antibody 16D9 (IgG2b isotype). This antibody was raised against GST-tagged Cav1.4 fusion protein encoding aa1-aa121 of mouse Cav1.4. The PCR insert was amplified from a cDNA encoding mouse Cav1.4 (OMM4760-99847681 [BioCat]) and primers AAAAGAATTCTAATGTCGGAATCTGAAGTC (forward), AAAACCATGGTGTTGGAGTCGTCCTCA (reverse) and cloned into the activity-dependent modulations of the active zone of photoreceptor synapses were observed94. The molecular composition of the active zone is crucial for presynaptic signaling1,95. The molecular mechanisms of how the ribbon contributes to the darkness-induced increased recruitment of Cav1.4 and RIM2 to the active zone remain to be elucidated. One possible mechanism could be that ribbon-associated vesicles might serve Mouse Monoclonal to Rabbit IgG as vehicles for the delivery of active zone proteins. According to this hypothesis, increased exocytosis of these vesicles in the dark, when the photoreceptor is usually depolarized, could promote formation of larger active zones. Specialized.
Related Stories
April 7, 2026